Stem-loop sequence osa-MIR2118o

AccessionMI0011265 (change log)
DescriptionOryza sativa miR2118o stem-loop
Gene family MIPF0000745; MIR2118
Literature search

29 open access papers mention osa-MIR2118o
(165 sentences)

Stem-loop
              aaaa   g                 a    - a   ga    au     -   -  c         c  g 
5' ggaagaggaag    gag gccaaggagcagugggc uggg g cau  agga  gcuua agc cc ucuccaauc uc c
   |||||||||||    ||| ||||||||||||||||| |||| | |||  ||||  ||||| ||| || ||||||||| ||  
3' ccuucuccuuc    cuc ugguuccuuguuauccg accc c gua  uccu  ugagu uug gg agagguuag ag a
              ----   g                 a    u c   -g    cu     a   a  u         -  u 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21661272-21661426 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118o
osa-MIR2118nChr4: 21661494-21661672 [-]
osa-MIR2118oChr4: 21661272-21661426 [-]
osa-MIR2118mChr4: 21658851-21659020 [-]
osa-MIR2118kChr4: 21656944-21657120 [-]
osa-MIR2118lChr4: 21656708-21656884 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
Database links

Mature sequence osa-miR2118o

Accession MIMAT0011754
Sequence

107 - 

cuccugaugccucccaagccua

 - 128

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).