Stem-loop sequence osa-MIR2118n

AccessionMI0011264 (change log)
DescriptionOryza sativa miR2118n stem-loop
Gene family MIPF0000745; MIR2118
Literature search

28 open access papers mention osa-MIR2118n
(166 sentences)

Stem-loop
         ---c             aagag  a  c       a            -a   -  ag       uaa             u      g 
5' gugagc    aggaagaggaaga     ag gc uaagagc gugggaauggga  cau gg  gaaagcc   aaaccaaauuucu ccucca c
   ||||||    |||||||||||||     || || ||||||| ||||||||||||  ||| ||  |||||||   ||||||||||||| ||||||  
3' cgcucg    uccuucuccuucu     uc cg auucuug uauccuuacccu  gua cc  uuuuugg   uuugguuuaaagg ggaggu a
         acuu             -----  a  a       c            cc   g  cu       ---             u      a 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21661494-21661672 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118n
osa-MIR2118nChr4: 21661494-21661672 [-]
osa-MIR2118oChr4: 21661272-21661426 [-]
osa-MIR2118mChr4: 21658851-21659020 [-]
osa-MIR2118kChr4: 21656944-21657120 [-]
osa-MIR2118lChr4: 21656708-21656884 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
Database links

Mature sequence osa-miR2118n

Accession MIMAT0011753
Sequence

120 - 

uucccgaugccucccauuccua

 - 141

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).