Stem-loop sequence osa-MIR2118m

AccessionMI0011263 (change log)
DescriptionOryza sativa miR2118m stem-loop
Gene family MIPF0000745; MIR2118
Literature search

28 open access papers mention osa-MIR2118m
(163 sentences)

Stem-loop
       --    --   -       --u  a   u        a            -a   ga       - --caa      -           
5' ggug  agcc  agg aagagga   ag gac cuaagagc guaggaauggga  cau  aggaaag c     accaag cucuaacucc 
   ||||  ||||  ||| |||||||   || ||| |||||||| ||||||||||||  |||  ||||||| |     |||||| ||||||||| u
3' ccac  ucgg  uuc uucuccu   uc cug gauucuug cauccuuacccu  gua  uccuuuu g     ugguuu gagguugagg 
       aa    cu   a       ugu  -   -        a            cc   -g       a caaua      a           
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21658851-21659020 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118m
osa-MIR2118nChr4: 21661494-21661672 [-]
osa-MIR2118oChr4: 21661272-21661426 [-]
osa-MIR2118mChr4: 21658851-21659020 [-]
osa-MIR2118kChr4: 21656944-21657120 [-]
osa-MIR2118lChr4: 21656708-21656884 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118gChr4: 21650301-21650460 [-]
Database links

Mature sequence osa-miR2118m

Accession MIMAT0011752
Sequence

108 - 

uuccugaugccucccauuccua

 - 129

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).