Stem-loop sequence osa-MIR2118k

AccessionMI0011261 (change log)
DescriptionOryza sativa miR2118k stem-loop
Gene family MIPF0000745; MIR2118
Literature search

28 open access papers mention osa-MIR2118k
(162 sentences)

Stem-loop
           ---           aaaga        c     u            -c   ga        -cu     cuauug   -      g 
5' gcaagcca   ggaagaggaag     gaguaucu agaau gugggaaugaga  cau  aggaaagc   aagcu      ucc ccucua u
   ||||||||   |||||||||||     |||||||| ||||| ||||||||||||  |||  ||||||||   |||||      ||| ||||||  
3' cguucggu   ccuucuccuuc     cucgugga ucuug uauccuuacucu  gua  uccuuuug   uuuga      agg ggaggu a
           uuu           -----        u     u            cc   -g        uac     -uucaa   u      u 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21656944-21657120 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118k
osa-MIR2118nChr4: 21661494-21661672 [-]
osa-MIR2118oChr4: 21661272-21661426 [-]
osa-MIR2118mChr4: 21658851-21659020 [-]
osa-MIR2118kChr4: 21656944-21657120 [-]
osa-MIR2118lChr4: 21656708-21656884 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118gChr4: 21650301-21650460 [-]
osa-MIR2118cChr4: 21647968-21648064 [-]
osa-MIR2118dChr4: 21647689-21647864 [-]
osa-MIR2118eChr4: 21647428-21647604 [-]
Database links

Mature sequence osa-miR2118k

Accession MIMAT0011750
Sequence

118 - 

uuccugaugccucucauuccua

 - 139

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).