Stem-loop sequence osa-MIR2118k

Accession MI0011261
Description Oryza sativa miR2118k stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop 
        ---           aaaga        c     u            -c   ga        -cu     cuauug   -      g 
gcaagcca   ggaagaggaag     gaguaucu agaau gugggaaugaga  cau  aggaaagc   aagcu      ucc ccucua u
||||||||   |||||||||||     |||||||| ||||| ||||||||||||  |||  ||||||||   |||||      ||| ||||||  
cguucggu   ccuucuccuuc     cucgugga ucuug uauccuuacucu  gua  uccuuuug   uuuga      agg ggaggu a
        uuu           -----        u     u            cc   -g        uac     -uucaa   u      u
Get sequence
Deep sequencing
19 reads, 2 experiments
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21656944-21657120 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118k
osa-MIR2118n Chr4: 21661494-21661672 [-]
osa-MIR2118o Chr4: 21661272-21661426 [-]
osa-MIR2118m Chr4: 21658851-21659020 [-]
osa-MIR2118k Chr4: 21656944-21657120 [-]
osa-MIR2118l Chr4: 21656708-21656884 [-]
osa-MIR2118j Chr4: 21654594-21654764 [-]
osa-MIR2118h Chr4: 21652652-21652808 [-]
osa-MIR2118i Chr4: 21652388-21652568 [-]
osa-MIR2118f Chr4: 21650514-21650682 [-]
osa-MIR5522 Chr4: 21650324-21650436 [+]
osa-MIR2118g Chr4: 21650301-21650460 [-]
osa-MIR2118c Chr4: 21647968-21648064 [-]
osa-MIR2118d Chr4: 21647689-21647864 [-]
osa-MIR2118e Chr4: 21647428-21647604 [-]

Mature sequence osa-miR2118k

Accession MIMAT0011750
Sequence

118 -  

uuccugaugccucucauuccua

 - 139

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).