Stem-loop sequence osa-MIR2118j

AccessionMI0011260 (change log)
DescriptionOryza sativa miR2118j stem-loop
Gene family MIPF0000745; MIR2118
Literature search

28 open access papers mention osa-MIR2118j
(162 sentences)

Stem-loop
       --   --c   -        ga   -  u        a            -a   ga      --------       uaag     --     
5' ggug  agc   agg aagaggaa  gag ac cuaagagc guaggaauggga  cau  aggaaa        gccaaau    cucua  accu 
   ||||  |||   ||| ||||||||  ||| || |||||||| ||||||||||||  |||  ||||||        |||||||    |||||  ||| c
3' ccac  ucg   uuc uucuccuu  cuc ug gauucuug uauccuuacccu  gua  uccuuu        ugguuua    gaggu  uggu 
       aa   acu   a        -g   g  -        a            cc   -g      uaguaguc       ----     ua     
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21654594-21654764 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118j
osa-MIR2118nChr4: 21661494-21661672 [-]
osa-MIR2118oChr4: 21661272-21661426 [-]
osa-MIR2118mChr4: 21658851-21659020 [-]
osa-MIR2118kChr4: 21656944-21657120 [-]
osa-MIR2118lChr4: 21656708-21656884 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118gChr4: 21650301-21650460 [-]
osa-MIR2118cChr4: 21647968-21648064 [-]
osa-MIR2118dChr4: 21647689-21647864 [-]
osa-MIR2118eChr4: 21647428-21647604 [-]
osa-MIR2118bChr4: 21645285-21645463 [-]
osa-MIR1869Chr4: 21644852-21644989 [+]
Database links

Mature sequence osa-miR2118j

Accession MIMAT0011749
Sequence

109 - 

uuccugaugccucccauuccua

 - 130

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).