Stem-loop sequence osa-MIR2118i

AccessionMI0011259 (change log)
DescriptionOryza sativa miR2118i stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop
         ---             aaauu                 c         -a    g        - ---u   gc      cu g     u 
5' gcaagu   aaggaagaggaag     gagugucuaagggcaau ggaauggga  cauu aggaaagc c    aca  gucuuu  c uccac a
   ||||||   |||||||||||||     ||||||||||||||||| |||||||||  |||| |||||||| |    |||  ||||||  | ||||| g
3' cguucg   uuccuucuccuuc     cucauagauuccuguua ccuuacccu  guga uccuuuug g    ugu  uagaaa  g gggug a
         acu             -----                 u         cc    -        u uuuu   aa      ug g     a 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21652388-21652568 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118i
osa-MIR2118nChr4: 21661494-21661672 [-]
osa-MIR2118oChr4: 21661272-21661426 [-]
osa-MIR2118mChr4: 21658851-21659020 [-]
osa-MIR2118kChr4: 21656944-21657120 [-]
osa-MIR2118lChr4: 21656708-21656884 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118gChr4: 21650301-21650460 [-]
osa-MIR2118cChr4: 21647968-21648064 [-]
osa-MIR2118dChr4: 21647689-21647864 [-]
osa-MIR2118eChr4: 21647428-21647604 [-]
osa-MIR2118bChr4: 21645285-21645463 [-]
osa-MIR1869Chr4: 21644852-21644989 [+]
osa-MIR2118aChr4: 21642923-21643101 [-]
Database links

Mature sequence osa-miR2118i

Accession MIMAT0011748
Sequence

122 - 

uuccuagugccucccauuccua

 - 143

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).