Stem-loop sequence osa-MIR2118h

AccessionMI0011258 (change log)
DescriptionOryza sativa miR2118h stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop
              aaaga   g   uc    au            -a   ga       u uaa       u    ---     a 
5' ggaagaggaag     gag auc  agaa  guaggaaugaga  cau  aggaaag c   gagcuaa gucu   ccucu c
   |||||||||||     ||| |||  ||||  ||||||||||||  |||  ||||||| |   ||||||| ||||   ||||| a
3' ccuucuccuuc     cuc ugg  ucuu  uauccuuacucu  gua  uccuuuu g   uuugauu caga   ggagg u
              -----   g   ga    gg            cc   -g       - uac       -    gcu     u 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21652652-21652808 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118h
osa-MIR2118nChr4: 21661494-21661672 [-]
osa-MIR2118oChr4: 21661272-21661426 [-]
osa-MIR2118mChr4: 21658851-21659020 [-]
osa-MIR2118kChr4: 21656944-21657120 [-]
osa-MIR2118lChr4: 21656708-21656884 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118gChr4: 21650301-21650460 [-]
osa-MIR2118cChr4: 21647968-21648064 [-]
osa-MIR2118dChr4: 21647689-21647864 [-]
osa-MIR2118eChr4: 21647428-21647604 [-]
osa-MIR2118bChr4: 21645285-21645463 [-]
osa-MIR1869Chr4: 21644852-21644989 [+]
osa-MIR2118aChr4: 21642923-21643101 [-]
Database links

Mature sequence osa-miR2118h

Accession MIMAT0011747
Sequence

109 - 

uuccugaugccucucauuccua

 - 130

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).