Stem-loop sequence osa-MIR2118g

AccessionMI0011257 (change log)
DescriptionOryza sativa miR2118g stem-loop
Gene family MIPF0000745; MIR2118
Literature search

28 open access papers mention osa-MIR2118g
(162 sentences)

Stem-loop
       -   -u            aca   g          u            -a   gg        -      ------     g 
5' guga acu  gggaagaggaag   gag gucuaagagc guaggaauggga  cau  aggaaagu gcaagc      uccau u
   |||| |||  ||||||||||||   ||| |||||||||| ||||||||||||  |||  |||||||| ||||||      |||||  
3' cacu ugg  uccuucuccuuc   cuc uggauucuug uauccuuacccu  gua  uccuuuca cguucg      aggug u
       c   uu            ---   g          u            cc   -a        a      guucag     u 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21650301-21650460 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118g
osa-MIR2118mChr4: 21658851-21659020 [-]
osa-MIR2118kChr4: 21656944-21657120 [-]
osa-MIR2118lChr4: 21656708-21656884 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118gChr4: 21650301-21650460 [-]
osa-MIR2118cChr4: 21647968-21648064 [-]
osa-MIR2118dChr4: 21647689-21647864 [-]
osa-MIR2118eChr4: 21647428-21647604 [-]
osa-MIR2118bChr4: 21645285-21645463 [-]
osa-MIR1869Chr4: 21644852-21644989 [+]
osa-MIR2118aChr4: 21642923-21643101 [-]
Database links

Mature sequence osa-miR2118g

Accession MIMAT0011746
Sequence

101 - 

uuccuaaugccucccauuccua

 - 122

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).