Stem-loop sequence osa-MIR2118f

AccessionMI0011256 (change log)
DescriptionOryza sativa miR2118f stem-loop
Gene family MIPF0000745; MIR2118
Literature search

28 open access papers mention osa-MIR2118f
(163 sentences)

Stem-loop
    ug     ---      a     aacga   g uu   u                -a   g a        ug -  ucuaa       c 
5' g  agcca   gggaag ggaag     gag g  caa agcagugggaauggga  cau g ggaaagca  a gc     auuuccu c
   |  |||||   |||||| |||||     ||| |  ||| ||||||||||||||||  ||| | ||||||||  | ||     |||||||  
3' c  ucggu   uccuuc ccuuc     cuc u  guu uuguuauccuuacccu  gua u ccuuuugu  u cg     uagagga a
    gu     ucu      c     -----   g gg   c                cc   g -        gu u  --ucc       a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21650514-21650682 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118f
osa-MIR2118mChr4: 21658851-21659020 [-]
osa-MIR2118kChr4: 21656944-21657120 [-]
osa-MIR2118lChr4: 21656708-21656884 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118gChr4: 21650301-21650460 [-]
osa-MIR2118cChr4: 21647968-21648064 [-]
osa-MIR2118dChr4: 21647689-21647864 [-]
osa-MIR2118eChr4: 21647428-21647604 [-]
osa-MIR2118bChr4: 21645285-21645463 [-]
osa-MIR1869Chr4: 21644852-21644989 [+]
osa-MIR2118aChr4: 21642923-21643101 [-]
Database links

Mature sequence osa-miR2118f

Accession MIMAT0011745
Sequence

109 - 

uuccugaugccucccauuccua

 - 130

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).