Stem-loop sequence osa-MIR2118e

Accession MI0011255
Description Oryza sativa miR2118e stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop 
   g  u       a     aaaa   a          a c          -a   g a      aac         uuuc   -c      a 
agu ag caggaag ggaag    gag gucuaagagc g aggcauggga  cau g ggaaaa   auauauagu    uuc  ccucua a
||| || ||||||| |||||    ||| |||||||||| | ||||||||||  ||| | ||||||   |||||||||    |||  ||||||  
ucg uu guccuuc ccuuc    cuc cggauucuug c uccguacccu  gua c ccuuuu   ugugugucg    aag  ggagau g
   g  -       a     ----   a          a a          cc   a -      ---         uuua   uu      u
Get sequence
Deep sequencing
167 reads, 3 experiments
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21647428-21647604 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118e
osa-MIR2118k Chr4: 21656944-21657120 [-]
osa-MIR2118l Chr4: 21656708-21656884 [-]
osa-MIR2118j Chr4: 21654594-21654764 [-]
osa-MIR2118h Chr4: 21652652-21652808 [-]
osa-MIR2118i Chr4: 21652388-21652568 [-]
osa-MIR2118f Chr4: 21650514-21650682 [-]
osa-MIR5522 Chr4: 21650324-21650436 [+]
osa-MIR2118g Chr4: 21650301-21650460 [-]
osa-MIR2118c Chr4: 21647968-21648064 [-]
osa-MIR2118d Chr4: 21647689-21647864 [-]
osa-MIR2118e Chr4: 21647428-21647604 [-]
osa-MIR2118b Chr4: 21645285-21645463 [-]
osa-MIR1869 Chr4: 21644852-21644989 [+]
osa-MIR2118a Chr4: 21642923-21643101 [-]

Mature sequence osa-miR2118e

Accession MIMAT0011744
Sequence

121 -  

uucccaaugccucccaugccua

 - 142

Get sequence
Deep sequencing 2 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).