Stem-loop sequence osa-MIR2118d

AccessionMI0011254 (change log)
DescriptionOryza sativa miR2118d stem-loop
Gene family MIPF0000745; MIR2118
Literature search

29 open access papers mention osa-MIR2118d
(165 sentences)

           ---           aaaa   g                       -a   g a       --cc     -cu    c       g 
5' guggauca   ggaagaggaag    gag gucugagagcggugggcauggga  cau g ggaaagc    aaacu   ucuu gccucua a
   ||||||||   |||||||||||    ||| |||||||||||||||||||||||  ||| | |||||||    |||||   |||| |||||||  
3' cgcuuggu   ccuucuccuuc    cuc uagacucuuguuauccguacccu  gua u ccuuuug    uuugg   agag cggggau a
           uuu           ----   g                       cc   g -       uucc     uuu    u       c 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21647689-21647864 [-]
Clustered miRNAs
< 10kb from osa-MIR2118d
osa-MIR2118kChr4: 21656944-21657120 [-]
osa-MIR2118lChr4: 21656708-21656884 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118gChr4: 21650301-21650460 [-]
osa-MIR2118cChr4: 21647968-21648064 [-]
osa-MIR2118dChr4: 21647689-21647864 [-]
osa-MIR2118eChr4: 21647428-21647604 [-]
osa-MIR2118bChr4: 21645285-21645463 [-]
osa-MIR1869Chr4: 21644852-21644989 [+]
osa-MIR2118aChr4: 21642923-21643101 [-]
Database links

Mature sequence osa-miR2118d

Accession MIMAT0011743

117 - 


 - 138

Get sequence
Evidence experimental; 454 [1]


PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).