Stem-loop sequence osa-MIR2118c

Accession MI0011253
Description Oryza sativa miR2118c stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop 
           -a   g a       cuaa   u       cu     ag 
ugggaauagga  cau g ggaaagc    agc aaauuuu  gcucc  u
|||||||||||  ||| | |||||||    ||| |||||||  |||||   
auccuuauccu  gua c ccuuuug    ucg uuuagag  cgagg  a
           cc   g -       --ac   -       au     uu
Get sequence
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21647968-21648064 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118c
osa-MIR2118k Chr4: 21656944-21657120 [-]
osa-MIR2118l Chr4: 21656708-21656884 [-]
osa-MIR2118j Chr4: 21654594-21654764 [-]
osa-MIR2118h Chr4: 21652652-21652808 [-]
osa-MIR2118i Chr4: 21652388-21652568 [-]
osa-MIR2118f Chr4: 21650514-21650682 [-]
osa-MIR5522 Chr4: 21650324-21650436 [+]
osa-MIR2118g Chr4: 21650301-21650460 [-]
osa-MIR2118c Chr4: 21647968-21648064 [-]
osa-MIR2118d Chr4: 21647689-21647864 [-]
osa-MIR2118e Chr4: 21647428-21647604 [-]
osa-MIR2118b Chr4: 21645285-21645463 [-]
osa-MIR1869 Chr4: 21644852-21644989 [+]
osa-MIR2118a Chr4: 21642923-21643101 [-]

Mature sequence osa-miR2118c

Accession MIMAT0011742
Sequence

76 -  

uucccgaugccuccuauuccua

 - 97

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).