Stem-loop sequence osa-MIR2118c

AccessionMI0011253 (change log)
DescriptionOryza sativa miR2118c stem-loop
Gene family MIPF0000745; MIR2118
Literature search

29 open access papers mention osa-MIR2118c
(164 sentences)

Stem-loop
              -a   g a       cuaa   u       cu     ag 
5' ugggaauagga  cau g ggaaagc    agc aaauuuu  gcucc  u
   |||||||||||  ||| | |||||||    ||| |||||||  |||||   
3' auccuuauccu  gua c ccuuuug    ucg uuuagag  cgagg  a
              cc   g -       --ac   -       au     uu 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21647968-21648064 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118c
osa-MIR2118kChr4: 21656944-21657120 [-]
osa-MIR2118lChr4: 21656708-21656884 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118gChr4: 21650301-21650460 [-]
osa-MIR2118cChr4: 21647968-21648064 [-]
osa-MIR2118dChr4: 21647689-21647864 [-]
osa-MIR2118eChr4: 21647428-21647604 [-]
osa-MIR2118bChr4: 21645285-21645463 [-]
osa-MIR1869Chr4: 21644852-21644989 [+]
osa-MIR2118aChr4: 21642923-21643101 [-]
Database links

Mature sequence osa-miR2118c

Accession MIMAT0011742
Sequence

76 - 

uucccgaugccuccuauuccua

 - 97

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).