Stem-loop sequence osa-MIR2118b

AccessionMI0011252 (change log)
DescriptionOryza sativa miR2118b stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop
         ---             aaa   g  g         a            -a   a a         agcucu   -           gg 
5' augagc   gaggaagaggaag   gag ua ucuaagagc gugggaauggga  cau g ggaaaaaug      cag uguucacuucu  a
   ||||||   |||||||||||||   ||| || ||||||||| ||||||||||||  ||| | |||||||||      ||| |||||||||||   
3' uacucg   uuccuucuccuuc   cuc gu ggauucuug uauccuuacccu  gua c ccuuuuuau      guu auagguggagg  a
         acu             ---   -  -         c            cc   g -         gacucu   u           ug 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21645285-21645463 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118b
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118gChr4: 21650301-21650460 [-]
osa-MIR2118cChr4: 21647968-21648064 [-]
osa-MIR2118dChr4: 21647689-21647864 [-]
osa-MIR2118eChr4: 21647428-21647604 [-]
osa-MIR2118bChr4: 21645285-21645463 [-]
osa-MIR1869Chr4: 21644852-21644989 [+]
osa-MIR2118aChr4: 21642923-21643101 [-]
Database links

Mature sequence osa-miR2118b

Accession MIMAT0011741
Sequence

120 - 

uucccgaugccucccauuccua

 - 141

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).