Stem-loop sequence osa-MIR2118b

Accession MI0011252
Description Oryza sativa miR2118b stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop 
      ---             aaa   g  g         a            -a   a a         agcucu   -           gg 
augagc   gaggaagaggaag   gag ua ucuaagagc gugggaauggga  cau g ggaaaaaug      cag uguucacuucu  a
||||||   |||||||||||||   ||| || ||||||||| ||||||||||||  ||| | |||||||||      ||| |||||||||||   
uacucg   uuccuucuccuuc   cuc gu ggauucuug uauccuuacccu  gua c ccuuuuuau      guu auagguggagg  a
      acu             ---   -  -         c            cc   g -         gacucu   u           ug
Get sequence
Deep sequencing
24 reads, 2 experiments
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21645285-21645463 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118b
osa-MIR2118j Chr4: 21654594-21654764 [-]
osa-MIR2118h Chr4: 21652652-21652808 [-]
osa-MIR2118i Chr4: 21652388-21652568 [-]
osa-MIR2118f Chr4: 21650514-21650682 [-]
osa-MIR5522 Chr4: 21650324-21650436 [+]
osa-MIR2118g Chr4: 21650301-21650460 [-]
osa-MIR2118c Chr4: 21647968-21648064 [-]
osa-MIR2118d Chr4: 21647689-21647864 [-]
osa-MIR2118e Chr4: 21647428-21647604 [-]
osa-MIR2118b Chr4: 21645285-21645463 [-]
osa-MIR1869 Chr4: 21644852-21644989 [+]
osa-MIR2118a Chr4: 21642923-21643101 [-]

Mature sequence osa-miR2118b

Accession MIMAT0011741
Sequence

120 -  

uucccgaugccucccauuccua

 - 141

Get sequence
Deep sequencing 3 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).