Stem-loop sequence osa-MIR2118a

AccessionMI0011251 (change log)
DescriptionOryza sativa miR2118a stem-loop
Gene family MIPF0000745; MIR2118
Literature search

29 open access papers mention osa-MIR2118a
(168 sentences)

Stem-loop
   g           aaaga    c        ua      c     -a   a           --    ucu   caucua      cc ucc     g 
5'  ggaagaggaag     gagg uccaagag  guagga uggga  cau ugagaaagcau  gagc   auc      uccauc  c   cauuc c
    |||||||||||     |||| ||||||||  |||||| |||||  ||| |||||||||||  ||||   |||      ||||||  |   |||||  
3'  ccuucuccuuc     cuuc agguucuu  uauccu acccu  gua gcucuuuugua  cucg   uag      aggugg  g   guaag u
   -           -----    a        gc      u     cc   -           uu    cuu   ------      ac -uu     a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21642923-21643101 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118a
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118gChr4: 21650301-21650460 [-]
osa-MIR2118cChr4: 21647968-21648064 [-]
osa-MIR2118dChr4: 21647689-21647864 [-]
osa-MIR2118eChr4: 21647428-21647604 [-]
osa-MIR2118bChr4: 21645285-21645463 [-]
osa-MIR1869Chr4: 21644852-21644989 [+]
osa-MIR2118aChr4: 21642923-21643101 [-]
Database links

Mature sequence osa-miR2118a

Accession MIMAT0011740
Sequence

131 - 

uucucgaugccucccauuccua

 - 152

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).