Stem-loop sequence ppc-mir-2241a-1

AccessionMI0011246 (change log)
DescriptionPristionchus pacificus miR-2241a-1 stem-loop
Gene family MIPF0000821; mir-2241
Stem-loop
   -      uac   u        c    uc   guc       -  a 
5'  auucga   gcc cugaucuu agga  ccu   ugaacac cg a
    ||||||   ||| |||||||| ||||  |||   ||||||| ||  
3'  uaagcu   cgg gacuagaa uccu  gga   gcuugug gu a
   c      --c   -        c    ua   -ac       a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000012.1: 4725724-4725811 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-2241a-1
ppc-mir-2241b-1ABKE03000012.1: 4724898-4724994 [+]
ppc-mir-2241cABKE03000012.1: 4725036-4725132 [+]
ppc-mir-2241b-2ABKE03000012.1: 4725174-4725270 [+]
ppc-mir-2241a-2ABKE03000012.1: 4725593-4725680 [+]
ppc-mir-2241a-1ABKE03000012.1: 4725724-4725811 [+]
Database links

Mature sequence ppc-miR-2241a

Accession MIMAT0011731
Sequence

54 - 

uucgcaaggauuccucaagauc

 - 75

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).