Stem-loop sequence ppc-mir-279

AccessionMI0011244 (change log)
DescriptionPristionchus pacificus miR-279 stem-loop
Gene family MIPF0000184; mir-279
Literature search

1 open access papers mention ppc-mir-279
(4 sentences)

Stem-loop
      ug ug     uguu   u          ug   c       cuauccuu 
5' aug  c  ugucg    ccc gcuggguaug  ucu agucaug        g
   |||  |  |||||    ||| ||||||||||  ||| |||||||        u
3' ugc  g  gcggu    ggg cgacucauac  aga ucaguac        c
      gu uu     --uc   u          cu   -       ccauguug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000053.1: 567705-567808 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-279
ppc-mir-279ABKE03000053.1: 567705-567808 [+]
ppc-mir-2bABKE03000053.1: 567859-567966 [+]
Database links

Mature sequence ppc-miR-279

Accession MIMAT0011736
Sequence

66 - 

ugacuagauccauacucagcu

 - 86

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).