Stem-loop sequence ppc-mir-2251a

AccessionMI0011225 (change log)
Previous IDsppc-mir-2251
DescriptionPristionchus pacificus miR-2251 stem-loop
Gene family MIPF0000838; mir-2240
Stem-loop
      cgcua     cac u    a   c    -          uuu       ag 
5' gcc     cucga   g ccca auc ucau gaaucccggu   gaucacu  u
   |||     |||||   | |||| ||| |||| ||||||||||   |||||||   
3' cgg     gagcu   c gggu uag agua cuuagggcca   cuaguga  u
      ---aa     --u -    c   a    u          ---       cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000093.1: 9033595-9033694 [-]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-2251a
ppc-mir-2251aABKE03000093.1: 9033595-9033694 [-]
ppc-mir-2251bABKE03000093.1: 9033408-9033468 [-]
Database links

Mature sequence ppc-miR-2251a

Accession MIMAT0011720
Previous IDsppc-miR-2251
Sequence

63 - 

ucaccgggauucuaugaagaucu

 - 85

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).