Stem-loop sequence ppc-mir-38

AccessionMI0011218 (change log)
DescriptionPristionchus pacificus miR-38 stem-loop
Stem-loop
   c     u     cu  u     -  a    g           a    ucca 
5'  uucga cugag  gg gccug cc caua ugacucccggu acca    u
    ||||| |||||  || ||||| || |||| ||||||||||| ||||    u
3'  aggcu gacuc  cc cggac gg guau auugagggcca uggu    c
   -     -     --  -     a  -    a           c    ucag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000031.1: 559701-559798 [-]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-38
ppc-mir-8247ABKE03000031.1: 569077-569138 [+]
ppc-mir-8219ABKE03000031.1: 560126-560191 [-]
ppc-mir-8257ABKE03000031.1: 559971-560028 [-]
ppc-mir-38ABKE03000031.1: 559701-559798 [-]
ppc-mir-42bABKE03000031.1: 559584-559674 [-]
ppc-mir-8340ABKE03000031.1: 559439-559498 [-]
Database links

Mature sequence ppc-miR-38

Accession MIMAT0011714
Sequence

61 - 

ucaccgggaguuaauaugggac

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).