Stem-loop sequence ppc-mir-2266

AccessionMI0011204 (change log)
DescriptionPristionchus pacificus miR-2266 stem-loop
Stem-loop
   a    -      ag   cc    a   c  uu  gu         -   gau 
5'  uucg uuccuc  cgc  ucgg acc ga  gu  cuaguguuc ugu   u
    |||| ||||||  |||  |||| ||| ||  ||  ||||||||| |||   a
3'  aagc aaggag  gcg  agcc ugg cu  ca  gaucacgag acg   c
   -    c      --   --    c   a  cu  ug         u   aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000024.1: 401456-401555 [-]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-2266
ppc-mir-8280ABKE03000024.1: 401894-401960 [-]
ppc-mir-8225ABKE03000024.1: 401761-401823 [-]
ppc-mir-2265ABKE03000024.1: 401564-401653 [-]
ppc-mir-2266ABKE03000024.1: 401456-401555 [-]
ppc-mir-2237aABKE03000024.1: 401313-401403 [-]
ppc-mir-2237cABKE03000024.1: 401188-401278 [-]
ppc-mir-2237dABKE03000024.1: 401061-401121 [-]
ppc-mir-2237bABKE03000024.1: 400877-400968 [-]
Database links

Mature sequence ppc-miR-2266

Accession MIMAT0011701
Sequence

23 - 

aacccgauugugucuaguguuc

 - 44

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).