Stem-loop sequence ppc-mir-2240a-2

AccessionMI0011191 (change log)
DescriptionPristionchus pacificus miR-2240a-2 stem-loop
Gene family MIPF0000838; mir-2240
Stem-loop
   -   -     caac u    u    u    -     a   uuc      uaa 
5'  gcu acucg    g cccu aucu cuga aaucc ggu   gaucac   u
    ||| |||||    | |||| |||| |||| ||||| |||   ||||||    
3'  cgg ugagc    c ggga uagg gacu uuagg cca   cuagug   u
   u   c     --ua -    u    u    c     g   ---      ugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000048.1: 535876-535972 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-2240a-2
ppc-mir-2240cABKE03000048.1: 535739-535853 [+]
ppc-mir-2240a-2ABKE03000048.1: 535876-535972 [+]
ppc-mir-2240a-1ABKE03000048.1: 536003-536099 [+]
ppc-mir-2240bABKE03000048.1: 536132-536221 [+]
ppc-mir-2240a-1ABKE03000048.1: 536257-536353 [+]
Database links

Mature sequence ppc-miR-2240a

Accession MIMAT0011690
Sequence

59 - 

ucaccgggauucucaguggauu

 - 80

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).