Stem-loop sequence ppc-mir-46

AccessionMI0011147 (change log)
DescriptionPristionchus pacificus miR-46 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
       -cc  c     gca   a  -         --    ugu       -  --g   - g 
5' accc   gg accac   gag cc gaagagagc  cuuc   ugacagu gc   ggc c u
   ||||   || |||||   ||| || |||||||||  ||||   ||||||| ||   ||| |  
3' uggg   cc uggug   uuc gg cuucucucg  gagg   acuguua cg   ucg g u
       acu  -     ---   -  a         cu    --u       u  uaa   u g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000092.1: 4795409-4795519 [-]
intergenic
Database links

Mature sequence ppc-miR-46

Accession MIMAT0011655
Sequence

71 - 

ugucauggagucgcucucuuc

 - 91

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).