Stem-loop sequence ppc-mir-42a

AccessionMI0011129 (change log)
DescriptionPristionchus pacificus miR-42a stem-loop
Stem-loop
   -     uucag   a               cu   u    cu    -ugu   augc 
5'  gugca     ugc gcccgcagugggugu  gcc cggu  gaag    gag    a
    |||||     ||| |||||||||||||||  ||| ||||  ||||    |||     
3'  cacgu     acg cgggcguuaccuaca  ugg gcca  cuuc    cuc    u
   c     -----   -               ag   -    --    uugc   cuag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000123.1: 6561540-6561644 [-]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-42a
ppc-mir-42aABKE03000123.1: 6561540-6561644 [-]
ppc-mir-45ABKE03000123.1: 6561375-6561470 [-]
Database links

Mature sequence ppc-miR-42a

Accession MIMAT0011641
Sequence

71 - 

ucaccgggugaacauccauugc

 - 92

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).