Stem-loop sequence crm-mir-259

AccessionMI0011104 (change log)
DescriptionCaenorhabditis remanei miR-259 stem-loop
Gene family MIPF0000299; mir-259
Stem-loop
        acgga      a       -u  u    u   u a   aa a 
5' agccg     acgagu aaucuca  cc aauc ggu g cac  c c
   |||||     |||||| |||||||  || |||| ||| | |||  | a
3' ucggu     uguuca uuagggu  gg uuag cca c gug  g a
        aaagg      g       uc  u    -   u -   aa g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig60: 205404-205497 [-]
intergenic
Database links

Mature sequence crm-miR-259

Accession MIMAT0011607
Sequence

17 - 

aaaucucauccuaaucugguugac

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).