Stem-loop sequence crm-lin-4

AccessionMI0011095 (change log)
DescriptionCaenorhabditis remanei lin-4 stem-loop
Gene family MIPF0000303; lin-4
Literature search

1 open access papers mention crm-lin-4
(2 sentences)

Stem-loop
        cuga     ---   g    -cu   u    c    a       c   - u 
5' auguu    ugcuu   ucg ccug   ccc gaga cuca gugugag gca c g
   |||||    |||||   ||| ||||   ||| |||| |||| ||||||| ||| |  
3' uacag    acgag   ggc ggac   ggg cucu gggu cgcacuu cgu g u
        ----     uuc   a    cau   u    c    c       -   a u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig17: 1151377-1151480 [+]
intergenic
Database links

Mature sequence crm-lin-4-5p

Accession MIMAT0011599
Previous IDscrm-lin-4
Sequence

24 - 

ucccugagaccucaagugug

 - 43

Get sequence
Evidence experimental; 454 [1]

Mature sequence crm-lin-4-3p

Accession MIMAT0011600
Previous IDscrm-lin-4*
Sequence

63 - 

acgccugggcucucuggguacc

 - 84

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).