Stem-loop sequence crm-mir-1

AccessionMI0011077 (change log)
DescriptionCaenorhabditis remanei miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

1 open access papers mention crm-mir-1
(2 sentences)

Stem-loop
   -     --------    ag           c      gc     -    au 
5'  gcugu        gccg  cugcauacuuc uuacau  ccaua cuau  c
    |||||        ||||  ||||||||||| ||||||  ||||| ||||  a
3'  cggca        uggc  gauguaugaag aaugua  gguau ggua  g
   u     aaaaguuu    aa           a      -a     a    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig9: 244578-244673 [+]
intergenic
Database links

Mature sequence crm-miR-1-5p

Accession MIMAT0011565
Previous IDscrm-miR-1*
Sequence

15 - 

cauacuuccuuacaugcccau

 - 35

Get sequence
Evidence experimental; 454 [1]

Mature sequence crm-miR-1-3p

Accession MIMAT0011566
Previous IDscrm-miR-1
Sequence

55 - 

uggaauguaaagaaguaugu

 - 74

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).