Stem-loop sequence crm-mir-235

AccessionMI0011073 (change log)
DescriptionCaenorhabditis remanei miR-235 stem-loop
Gene family MIPF0000367; mir-235
Stem-loop
        uaca    gaaaauca          uu   c  a    u     -  ucag 
5' augga    aucu        agaucaggcc  ggc ga ugca auauu gc    u
   |||||    ||||        ||||||||||  ||| || |||| ||||| ||    u
3' uacuu    uaga        ucuaguccgg  ccg cu acgu uauaa cg    g
        ----    -augaaaa          cc   -  c    -     u  uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig4: 747854-747962 [+]
intergenic
Database links

Mature sequence crm-miR-235-5p

Accession MIMAT0011557
Previous IDscrm-miR-235*
Sequence

27 - 

aggccuuggccgaaugcauauauu

 - 50

Get sequence
Evidence experimental; 454 [1]

Mature sequence crm-miR-235-3p

Accession MIMAT0011558
Previous IDscrm-miR-235
Sequence

69 - 

uauugcacucgccccggccug

 - 89

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).