Stem-loop sequence crm-mir-79

AccessionMI0011072 (change log)
DescriptionCaenorhabditis remanei miR-79 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   -   --uaucaa     --aa  uu    u          uc     aa    ---ua   uc 
5'  gaa        auaga    gu  ccga cuuuggugau  agcuu  auga     gac  a
    |||        |||||    ||  |||| ||||||||||  |||||  ||||     |||  a
3'  cuu        uaucu    cg  ggcu gaaaccauug  ucgaa  uacu     uug  u
   u   uuuuuuuc     aagc  gc    c          ga     -a    ucaga   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig34: 372254-372373 [+]
intergenic
Database links

Mature sequence crm-miR-79-5p

Accession MIMAT0011555
Previous IDscrm-miR-79*
Sequence

26 - 

cuuuggugauucagcuuaaaug

 - 47

Get sequence
Evidence experimental; 454 [1]

Mature sequence crm-miR-79-3p

Accession MIMAT0011556
Previous IDscrm-miR-79
Sequence

71 - 

auaaagcuagguuaccaaagcu

 - 92

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).