Stem-loop sequence crm-mir-52-1

AccessionMI0011069 (change log)
DescriptionCaenorhabditis remanei miR-52-1 stem-loop
Gene family MIPF0000160; mir-52
Stem-loop
   u   c    cu    u c       c  a   uuc    c    cau 
5'  acc ucua  accg c acccgua au ugu   cgug uuga   u
    ||| ||||  |||| | ||||||| || |||   |||| ||||    
3'  ugg ggau  uggc g uggguau ua aca   gcac aacu   g
   -   c    uc    c c       a  -   -uu    u    cgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig1341: 55-147 [+]
intergenic
Clustered miRNAs
< 10kb from crm-mir-52-1
crm-mir-52-1Crem_Contig1341: 55-147 [+]
crm-mir-51-1Crem_Contig1341: 3371-3433 [+]
Database links

Mature sequence crm-miR-52-5p

Accession MIMAT0011549
Previous IDscrm-miR-52
Sequence

18 - 

cacccguacauauguuuccgugcu

 - 41

Get sequence
Evidence experimental; 454 [1]

Mature sequence crm-miR-52-3p

Accession MIMAT0011550
Previous IDscrm-miR-52*
Sequence

58 - 

cacguuacaauauaugggucg

 - 78

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).