Stem-loop sequence crm-mir-47

AccessionMI0011061 (change log)
DescriptionCaenorhabditis remanei miR-47 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
         --    -   ugaga           -a      u      uc  uuc 
5' gaaaaa  agcc gag     cugaagagagc  uucugu gacagu  ga   c
   ||||||  |||| |||     |||||||||||  |||||| ||||||  ||    
3' cuuuuu  ucgg cuc     gacuucucucg  gaggua cuguca  cu   g
         ga    u   uagug           cg      -      uc  caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig31: 438956-439060 [+]
intergenic
Database links

Mature sequence crm-miR-47

Accession MIMAT0011542
Sequence

62 - 

ugucauggaggcgcucucuuc

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).