Stem-loop sequence crm-mir-34

AccessionMI0011057 (change log)
DescriptionCaenorhabditis remanei miR-34 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   -    --g   c   -a a       -u   u     g   -  uau 
5'  ggac   gug ucg  g ggcagug  ggu agcug uug ca   u
    ||||   ||| |||  | |||||||  ||| ||||| ||| ||    
3'  ccug   uac agc  c ccgucac  cca ucggc aac gu   g
   a    aug   a   cc a       uu   -     -   a  uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig15: 1362286-1362373 [+]
intergenic
Database links

Mature sequence crm-miR-34

Accession MIMAT0011538
Sequence

15 - 

aggcagugugguuagcugguug

 - 36

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).