Stem-loop sequence cbr-mir-74b

AccessionMI0011017 (change log)
DescriptionCaenorhabditis briggsae miR-74b stem-loop
Gene family MIPF0000275; mir-74
Stem-loop
      -    -uucaa   c         u        u   uc  guuc        aug 
5' gcu acua      gcc cugccacac uuuggacu ccu  uc    ccagcaaa   c
   ||| ||||      ||| ||||||||| |||||||| |||  ||    ||||||||    
3' uga uggu      cgg gacggugug agaccuga gga  ag    ggucguuu   a
      g    uuuuga   c         u        c   uc  -aac        gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 4426711-4426827 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-74b
cbr-mir-2231chrX: 4430575-4430638 [-]
cbr-mir-73achrX: 4426887-4426980 [-]
cbr-mir-74bchrX: 4426711-4426827 [-]
cbr-mir-74achrX: 4426602-4426682 [-]
cbr-mir-785bchrX: 4421255-4421318 [+]
cbr-mir-75chrX: 4419739-4419830 [-]
Database links

Mature sequence cbr-miR-74b-5p

Accession MIMAT0011501
Previous IDscbr-miR-74b*
Sequence

29 - 

uggacuuccuucucguucccagc

 - 51

Get sequence
Evidence experimental; 454 [1]

Mature sequence cbr-miR-74b-3p

Accession MIMAT0011502
Previous IDscbr-miR-74b
Sequence

68 - 

uggcaagacuaggcaguccag

 - 88

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).