|
miRBase |
|
Advanced warning: 8th Sept 2010 - the miRBase website should be considered to be at risk of significant downtime due to essential hardware maintenance.
Stem-loop sequence MI0011012 |
||||||||||||||
| Accession | MI0011012 | |||||||||||||
| ID | cbr-mir-54b | |||||||||||||
| Description | Caenorhabditis briggsae miR-54b stem-loop | |||||||||||||
| Stem-loop |
------- c u - c c uuuu cga u gagcac gag ugauc uugacucga ac ugga aucg guaca ag c |||||| ||| ||||| ||||||||| || |||| |||| ||||| || a uucgug uuc gcuag aacugagcu ug accu uagu caugu uc a uaaaaau c c a u - -gcc -cg g |
|||||||||||||
| Genome context |
|
|||||||||||||
| Clustered miRNAs |
|
|||||||||||||
Mature sequence MIMAT0011494 |
|
| Accession | MIMAT0011494 |
| ID | cbr-miR-54b |
| Sequence |
63 - uacccgugauuccauguaucgag - 85 |
| Evidence | experimental; 454 [1] |
| Predicted targets |
|
References |
|
| 1 |
"Repertoire and evolution of miRNA genes in four divergent nematode species"
Genome Res. 19:2064-2074(2009).
|