Stem-loop sequence cbr-mir-2222-1

AccessionMI0011004 (change log)
DescriptionCaenorhabditis briggsae miR-2222-1 stem-loop
Gene family MIPF0001012; mir-2222
Stem-loop
   c       g      uaccagu            cc   -     uc           - a 
5'  augaaug ucaggu       cgaccugugcug  ucu uucuu  gugauauuuuu c c
    ||||||| ||||||       ||||||||||||  ||| |||||  ||||||||||| | a
3'  uauuuac agucca       gcuggacacgac  aga aagaa  cacuauaaaaa g g
   -       -      ----uuu            cu   c     --           u c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 20535778-20535892 [+]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-2222-1
cbr-mir-7587chrX: 20533902-20533963 [+]
cbr-mir-2222-1chrX: 20535778-20535892 [+]
cbr-mir-2222-2chrX: 20537156-20537270 [-]
Database links

Mature sequence cbr-miR-2222

Accession MIMAT0011487
Sequence

71 - 

uaucacaagaacagauccagcac

 - 93

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).