|
miRBase |
|
Advanced warning: 8th Sept 2010 - the miRBase website should be considered to be at risk of significant downtime due to essential hardware maintenance.
Stem-loop sequence MI0010998 |
||||||||||||||||||||||||||||||||||
| Accession | MI0010998 | |||||||||||||||||||||||||||||||||
| ID | cbr-mir-35b-10 | |||||||||||||||||||||||||||||||||
| Description | Caenorhabditis briggsae miR-35b-10 stem-loop | |||||||||||||||||||||||||||||||||
| Stem-loop |
---c a - u cg ug uc g uu aa
ga g g cuggaucggaccuc c guuuu cc cggugaua ccg g
|| | | |||||||||||||| | ||||| || |||||||| ||| c
cu c c gaccuagccuggag g caaaa gg gccacuau ggu a
gcua a a u au gu gu - -u ga
|
|||||||||||||||||||||||||||||||||
| Genome context |
|
|||||||||||||||||||||||||||||||||
| Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||
| Gene family |
MIPF0000096; mir-36 |
|||||||||||||||||||||||||||||||||
Mature sequence MIMAT0011483 |
|
| Accession | MIMAT0011483 |
| ID | cbr-miR-35b |
| Sequence |
63 - ucaccgggugaaaacugguagag - 85 |
| Evidence | experimental; 454 [1] |
| Predicted targets |
|
References |
|
| 1 |
"Repertoire and evolution of miRNA genes in four divergent nematode species"
Genome Res. 19:2064-2074(2009).
|