Stem-loop sequence cbr-mir-58b

AccessionMI0010988 (change log)
DescriptionCaenorhabditis briggsae miR-58b stem-loop
Stem-loop
   u     --u   aauacguu         gc          -   uuu 
5'  gaaau   uuc        ggcuuuuug  uggucucaua ccg   a
    |||||   |||        |||||||||  |||||||||| |||    
3'  cuuua   gag        ccgaagaac  acuagaguau ggu   g
   a     cuu   -aaaaaac         uu          a   cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrIV: 149566-149659 [+]
intergenic
Database links

Mature sequence cbr-miR-58b

Accession MIMAT0011482
Sequence

57 - 

ugagaucauucaagaagccc

 - 76

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).