Stem-loop sequence cbr-mir-1822

AccessionMI0010987 (change log)
DescriptionCaenorhabditis briggsae miR-1822 stem-loop
Gene family MIPF0001009; mir-1822
Stem-loop
       -agaa   u       c       -  aac  -ua      gcacu 
5' gucu     agg ccgagag cuauccc gg   gc   ucgguu     u
   ||||     ||| ||||||| ||||||| ||   ||   ||||||     u
3' caga     uuc gguucuc gauaggg cc   cg   agccaa     u
       aagac   -       a       g  ---  ucg      aaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrII: 9704335-9704430 [-]
intergenic
Database links

Mature sequence cbr-miR-1822

Accession MIMAT0011481
Sequence

59 - 

cgagcugcccggggauagacucu

 - 81

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).