|
miRBase |
|
Advanced warning: 8th Sept 2010 - the miRBase website should be considered to be at risk of significant downtime due to essential hardware maintenance.
Stem-loop sequence MI0010980 |
||||||||||||||||||||||||||||||||||
| Accession | MI0010980 | |||||||||||||||||||||||||||||||||
| ID | cbr-mir-35c-2 | |||||||||||||||||||||||||||||||||
| Description | Caenorhabditis briggsae miR-35c-2 stem-loop | |||||||||||||||||||||||||||||||||
| Stem-loop |
- c u cg c c g uu aag ga ucgg ccug cca uuu cacc cggugaua cc c || |||| |||| ||| ||| |||| |||||||| || a cu agcc ggac ggu aaa gugg gccacuau gg a c - u au u a - -u caa |
|||||||||||||||||||||||||||||||||
| Genome context |
|
|||||||||||||||||||||||||||||||||
| Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||
| Gene family |
MIPF0000096; mir-36 |
|||||||||||||||||||||||||||||||||
Mature sequence MIMAT0011467 |
|
| Accession | MIMAT0011467 |
| ID | cbr-miR-35c |
| Sequence |
54 - ucaccgggugaaaauugguac - 74 |
| Evidence | experimental; 454 [1] |
| Predicted targets |
|
References |
|
| 1 |
"Repertoire and evolution of miRNA genes in four divergent nematode species"
Genome Res. 19:2064-2074(2009).
|