Stem-loop sequence cel-mir-2221

AccessionMI0010974 (change log)
DescriptionCaenorhabditis elegans miR-2221 stem-loop
Stem-loop
   -     uuauucuuac      cgaa                 cau      a     aua 
5'  uacau          uguccu    uacaaacuggcgguuug   ucacuu cauuu   a
    |||||          ||||||    |||||||||||||||||   |||||| |||||   g
3'  gugua          auaggg    auguuugaucgccagac   agugaa guaaa   a
   a     -----uuuua      -aaa                 cau      c     aac 
Get sequence
Deep sequencing
60 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 1390847-1390964 [+]
intergenic
Database links

Mature sequence cel-miR-2221

Accession MIMAT0011463
Sequence

72 - 

caagugauaccagaccgcuagu

 - 93

Get sequence
Deep sequencing36 reads, 9 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).