Stem-loop sequence cel-mir-2220

AccessionMI0010973 (change log)
DescriptionCaenorhabditis elegans miR-2220 stem-loop
Stem-loop
   --     a        u   u     uuc 
5'   guaag ccauaaac auu aucaa   a
     ||||| |||||||| ||| |||||    
3'   cauuc gguguuug uaa uaguu   u
   ga     a        u   c     uac 
Get sequence
Deep sequencing
374 reads, 193 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 1873827-1873884 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-2220
cel-mir-4807chrX: 1872466-1872526 [+]
cel-mir-4808chrX: 1872952-1873008 [+]
cel-mir-4809chrX: 1873646-1873704 [+]
cel-mir-2220chrX: 1873827-1873884 [+]
cel-mir-4810bchrX: 1874016-1874075 [+]
cel-mir-4810achrX: 1875738-1875794 [+]
cel-mir-1018chrX: 1879458-1879513 [+]
cel-mir-4925chrX: 1879562-1879620 [+]
cel-mir-4923bchrX: 1879640-1879698 [+]
cel-mir-4923achrX: 1879876-1879936 [+]
cel-mir-4921chrX: 1879979-1880038 [+]
Database links

Mature sequence cel-miR-2220-5p

Accession MIMAT0011461
Previous IDscel-miR-2220*
Sequence

1 - 

guaagaccauaaacuauuuauc

 - 22

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence cel-miR-2220-3p

Accession MIMAT0011462
Previous IDscel-miR-2220
Sequence

37 - 

ucaauuguuuguggacuuacag

 - 58

Get sequence
Deep sequencing372 reads, 14 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1