Stem-loop sequence cel-mir-2219

AccessionMI0010972 (change log)
DescriptionCaenorhabditis elegans miR-2219 stem-loop
Stem-loop
   --a                a         -------   uu 
5'    cagcuuucucucgcac ucgucagcu       aga  u
      |||||||||||||||| |||||||||       |||  g
3'    gucgaaagggagcgug agcagucga       ucu  a
   gaa                a         aaguaug   ca 
Get sequence
Deep sequencing
142 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 2924580-2924655 [-]
intergenic
Database links

Mature sequence cel-miR-2219-5p

Accession MIMAT0011459
Previous IDscel-miR-2219*
Sequence

1 - 

acagcuuucucucgcacaucguc

 - 23

Get sequence
Deep sequencing68 reads, 13 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence cel-miR-2219-3p

Accession MIMAT0011460
Previous IDscel-miR-2219
Sequence

50 - 

cugacgaagugcgagggaaagc

 - 71

Get sequence
Deep sequencing72 reads, 12 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
2