Stem-loop sequence cel-mir-2218b

AccessionMI0010971 (change log)
DescriptionCaenorhabditis elegans miR-2218b stem-loop
Stem-loop
   --ag             uc      -ca    uu 
5'     acuacaaacuaca  auuuuc   ucuc  u
       |||||||||||||  ||||||   ||||   
3'     ugauguuugaugu  uaaaag   ggag  g
   agag             -u      auc    ug 
Get sequence
Deep sequencing
97 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 13834876-13834941 [-]
intergenic
Database links

Mature sequence cel-miR-2218b-5p

Accession MIMAT0011457
Previous IDscel-miR-2218b
Sequence

1 - 

agacuacaaacuacaucauuuuc

 - 23

Get sequence
Deep sequencing11 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence cel-miR-2218b-3p

Accession MIMAT0011458
Previous IDscel-miR-2218b*
Sequence

45 - 

aaauuuguaguuuguagugaga

 - 66

Get sequence
Deep sequencing86 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1