Stem-loop sequence cel-mir-2218a

AccessionMI0010970 (change log)
DescriptionCaenorhabditis elegans miR-2218a stem-loop
Stem-loop
   --         agu   aa        aaa 
5'   caaacuaca   uuu  gccucacc   a
     |||||||||   |||  ||||||||    
3'   guuugaugu   aag  cggagugg   g
   au         gau   ac        guu 
Get sequence
Deep sequencing
31 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 13812596-13812655 [+]
antisense
W09G3.8.1 ; W09G3.8.1; intron 2
W09G3.8.2 ; W09G3.8.2; intron 3
Database links

Mature sequence cel-miR-2218a-5p

Accession MIMAT0011455
Previous IDscel-miR-2218a
Sequence

1 - 

caaacuacaaguuuuaagccuca

 - 23

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence cel-miR-2218a-3p

Accession MIMAT0011456
Previous IDscel-miR-2218a*
Sequence

38 - 

aggccagaauaguguaguuugua

 - 60

Get sequence
Deep sequencing26 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1