Stem-loop sequence cel-mir-2209b

AccessionMI0010969 (change log)
DescriptionCaenorhabditis elegans miR-2209b stem-loop
Gene family MIPF0000787; mir-2209
Literature search

1 open access papers mention cel-mir-2209b
(1 sentences)

Stem-loop
   ---  ug    aa   u    c   -   aaac 
5'    ag  uaac  cuc ucuc uuc cga    c
      ||  ||||  ||| |||| ||| |||     
3'    uc  guug  gag agag aag gcu    a
   acu  gu    gc   u    -   a   aaua 
Get sequence
Deep sequencing
65 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 1021303-1021365 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-2209b
cel-mir-2209cchrIV: 1027218-1027281 [+]
cel-mir-2209achrIV: 1027101-1027164 [+]
cel-mir-2208bchrIV: 1026580-1026640 [+]
cel-mir-2208achrIV: 1021772-1021832 [+]
cel-mir-2209bchrIV: 1021303-1021365 [-]
Database links

Mature sequence cel-miR-2209b-5p

Accession MIMAT0011453
Previous IDscel-miR-2209b*
Sequence

1 - 

aguguaacaacucuucuccuuc

 - 22

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence cel-miR-2209b-3p

Accession MIMAT0011454
Previous IDscel-miR-2209b
Sequence

42 - 

agagaugagcgguugugcuuca

 - 63

Get sequence
Deep sequencing63 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1