Stem-loop sequence cel-mir-2217a

AccessionMI0010968 (change log)
Previous IDscel-mir-2217
DescriptionCaenorhabditis elegans miR-2217 stem-loop
Gene family MIPF0001912; mir-2217
Stem-loop
   -- ag  ug    guc  u        a au 
5'   c  ag  ggca   gg gucgaucu c  c
     |  ||  ||||   || |||||||| |  a
3'   g  uu  ccgu   cc cagcugga g  u
   ug cu  gu    guu  -        c cu 
Get sequence
Deep sequencing
195 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 5280075-5280136 [-]
intergenic
Database links

Mature sequence cel-miR-2217a-5p

Accession MIMAT0011451
Previous IDscel-miR-2217-5p
Sequence

1 - 

cagagugggcagucggugucgauc

 - 24

Get sequence
Deep sequencing116 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence cel-miR-2217a-3p

Accession MIMAT0011452
Previous IDscel-miR-2217-3p
Sequence

40 - 

ucgacccuugugccuguuucggu

 - 62

Get sequence
Deep sequencing78 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1