Stem-loop sequence cel-mir-1832b

AccessionMI0010967 (change log)
DescriptionCaenorhabditis elegans miR-1832b stem-loop
Stem-loop
   --             g           ----   a 
5'   cagcgaaucgcuc gcccacuuuug    uga c
     ||||||||||||| |||||||||||    ||| c
3'   gucgcuuagcgag cgggugaaaac    acu a
   ua             a           ugcg   a 
Get sequence
Deep sequencing
1043 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 17092861-17092927 [-]
sense
Y116A8C.27a ; Y116A8C.27a; intron 2
Y116A8C.27b.1 ; Y116A8C.27b.1; intron 2
Y116A8C.27b.2 ; Y116A8C.27b.2; intron 3
Database links

Mature sequence cel-miR-1832b-5p

Accession MIMAT0011449
Previous IDscel-miR-1832b*
Sequence

1 - 

cagcgaaucgcucggcccacuuu

 - 23

Get sequence
Deep sequencing121 reads, 10 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence cel-miR-1832b-3p

Accession MIMAT0011450
Previous IDscel-miR-1832b
Sequence

45 - 

agugggcagagcgauucgcugau

 - 67

Get sequence
Deep sequencing920 reads, 13 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1