Stem-loop sequence cel-mir-2216

AccessionMI0010966 (change log)
DescriptionCaenorhabditis elegans miR-2216 stem-loop
Stem-loop
   --             c          ca 
5'   gcacauuuuaagu gguaggcguc  a
     ||||||||||||| ||||||||||  u
3'   cguguaaaauuca cuauccguag  u
   uc             u          uu 
Get sequence
Deep sequencing
84 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 10867116-10867172 [-]
sense
M106.4a ; M106.4a; intron 1
M106.4b ; M106.4b; intron 2
Database links

Mature sequence cel-miR-2216-5p

Accession MIMAT0011447
Previous IDscel-miR-2216
Sequence

1 - 

gcacauuuuaagucgguaggc

 - 21

Get sequence
Deep sequencing80 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence cel-miR-2216-3p

Accession MIMAT0011448
Previous IDscel-miR-2216*
Sequence

37 - 

cuaucuacuuaaaaugugccu

 - 57

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1