Stem-loop sequence cel-mir-2215

AccessionMI0010965 (change log)
DescriptionCaenorhabditis elegans miR-2215 stem-loop
Literature search

1 open access papers mention cel-mir-2215
(1 sentences)

Stem-loop
   --                 g      uaguuc 
5'   acagcacguguuacgau cuccgu      g
     ||||||||||||||||| ||||||      g
3'   uguugugcgcgaugcua gaggca      a
   uu                 a      uuuuug 
Get sequence
Deep sequencing
243 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 13333763-13333827 [-]
intergenic
Database links

Mature sequence cel-miR-2215-5p

Accession MIMAT0011445
Previous IDscel-miR-2215*
Sequence

1 - 

acagcacguguuacgaugcucc

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence cel-miR-2215-3p

Accession MIMAT0011446
Previous IDscel-miR-2215
Sequence

44 - 

agaaucguagcgcguguuguuu

 - 65

Get sequence
Deep sequencing229 reads, 10 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1