Stem-loop sequence cel-mir-2213

AccessionMI0010963 (change log)
DescriptionCaenorhabditis elegans miR-2213 stem-loop
Stem-loop
   --u     -a     c         c u 
5'    ggcgg  cucuu acaguuuga c c
      |||||  ||||| ||||||||| | g
3'    ccguc  gagaa ugucgaacu g g
   aau     ag     -         a a 
Get sequence
Deep sequencing
108 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 6968870-6968924 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-2213
cel-mir-2213chrIII: 6968870-6968924 [+]
cel-mir-5549chrIII: 6971976-6972085 [-]
Database links

Mature sequence cel-miR-2213-5p

Accession MIMAT0011441
Previous IDscel-miR-2213*
Sequence

1 - 

uggcggacucuucacaguuuga

 - 22

Get sequence
Deep sequencing8 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence cel-miR-2213-3p

Accession MIMAT0011442
Previous IDscel-miR-2213
Sequence

34 - 

aagcuguaagaggacugccuaa

 - 55

Get sequence
Deep sequencing100 reads, 13 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1