Stem-loop sequence cel-mir-2212

AccessionMI0010962 (change log)
DescriptionCaenorhabditis elegans miR-2212 stem-loop
Literature search

1 open access papers mention cel-mir-2212
(1 sentences)

Stem-loop
   --    ag    uag   g      caagc 
5'   uggc  auca   gcu acuuug     a
     ||||  ||||   ||| ||||||     u
3'   accg  uagu   cgg ugaaac     u
   cu    aa    uua   -      auauu 
Get sequence
Deep sequencing
1048 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 16207829-16207888 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-2212
cel-mir-2212chrX: 16207829-16207888 [+]
cel-mir-1819chrX: 16207955-16208035 [+]
Database links

Mature sequence cel-miR-2212-5p

Accession MIMAT0011439
Previous IDscel-miR-2212
Sequence

1 - 

uggcagaucauaggcugacuuug

 - 23

Get sequence
Deep sequencing1048 reads, 16 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence cel-miR-2212-3p

Accession MIMAT0011440
Previous IDscel-miR-2212*
Sequence

39 - 

aaguggcauuugauaagccauc

 - 60

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1