Stem-loop sequence cel-mir-2211

AccessionMI0010961 (change log)
DescriptionCaenorhabditis elegans miR-2211 stem-loop
Stem-loop
   --c    a    uuc  c       --      
5'    cucc ucua   uc aucugac  gacgu 
      |||| ||||   || |||||||  |||| c
3'    gagg agau   ag uggacug  cugcc 
   aaa    -    uua  a       cc      
Get sequence
Deep sequencing
1104 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 9447362-9447421 [+]
antisense
F46A9.6.2 ; F46A9.6.2; intron 1
Database links

Mature sequence cel-miR-2211-5p

Accession MIMAT0011437
Previous IDscel-miR-2211*
Sequence

1 - 

ccuccaucuauucuccaucugacg

 - 24

Get sequence
Deep sequencing1009 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence cel-miR-2211-3p

Accession MIMAT0011438
Previous IDscel-miR-2211
Sequence

38 - 

ucagguagaauuuagaggagaaa

 - 60

Get sequence
Deep sequencing94 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1